View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8518A_low_305 (Length: 232)
Name: NF8518A_low_305
Description: NF8518A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8518A_low_305 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 21 - 217
Target Start/End: Original strand, 32891866 - 32892062
Alignment:
| Q |
21 |
atccccccacccaacaatagacgtcgaaaagttccaaagagtgcgtttctcttggaacgctatggtccgcaagaattttctaacatgaccagaaaacttg |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32891866 |
atccccccacccaacaatagacgtcgaaaagttccaaagagtgcgtttctcttggaacgctatggtccgcaagaattttctaacatgaccagaaaacttg |
32891965 |
T |
|
| Q |
121 |
tctccccatcttccatattgttcatggtttgactccgagtagtaatctcaacatcagcaatttgatgttcttcattgtattccaagttctttgatgt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32891966 |
tctccccatcttccatattgttcatggtttgactccgagtagtaatctcaacatcaacaatttgatgttcttcattgtattccaagttctttgatgt |
32892062 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University