View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8518A_low_313 (Length: 230)
Name: NF8518A_low_313
Description: NF8518A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8518A_low_313 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 41332960 - 41332737
Alignment:
| Q |
1 |
aagtgaaatgactggtgagattgaagctaccagtcaaccatcttcctggtggaacatatagttgagaaccaccatttgatgagtactgactcaaatgatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41332960 |
aagtgaaatgactggtgagattgaagctaccagtcaaccatcttcctggtggaacatatagttgagaaccaccatttgatgagtactgactcaaatgatc |
41332861 |
T |
|
| Q |
101 |
tatggctgactgaaaagcttttgtgttcaaagtatttccatcgccgactgctccaaattctgtcaccgaggcactgtaagctctgcagctcacagcacaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
41332860 |
tatggctgactgaaaagcttttgtgttcaaagtatttccatcgccggccgctccaaattctgtcactgaggcactgtaagctctgcagctcacagcacaa |
41332761 |
T |
|
| Q |
201 |
tactcaaaatagaagtcctcaacc |
224 |
Q |
| |
|
|||||||||||| ||||||||||| |
|
|
| T |
41332760 |
tactcaaaatagtagtcctcaacc |
41332737 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 2 - 56
Target Start/End: Original strand, 34505980 - 34506034
Alignment:
| Q |
2 |
agtgaaatgactggtgagattgaagctaccagtcaaccatcttcctggtggaaca |
56 |
Q |
| |
|
||||||||| || |||||||||||||| ||||| |||||| | |||||||||||| |
|
|
| T |
34505980 |
agtgaaatggcttgtgagattgaagcttccagttaaccatttacctggtggaaca |
34506034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University