View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8518A_low_322 (Length: 230)
Name: NF8518A_low_322
Description: NF8518A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8518A_low_322 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 14 - 230
Target Start/End: Complemental strand, 53174315 - 53174104
Alignment:
| Q |
14 |
atttctttataaaaatggaatggtttatgttttgtagacatttggcaccagaatactacttgcatggagttgtggatgagaaaacagatgtgtttgcttt |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
53174315 |
atttctttataaaaatggaatggtttatgttttgtagacatttggcaccagaatactacttgcatggagttgtggatgagaaaacagatgtatttgcttt |
53174216 |
T |
 |
| Q |
114 |
tggtgtgttcttgctagaagtcatttctggtaggaaacctgtggatgtgtctcaccaaagtttacatagctgggtaagtaagtagagtagagtagagtag |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
53174215 |
tggtgtgttcttgctagaagtcatttctggtaggaaacctgtggatgtgtctcaccaaagtttacatagctgggtaagtaagtagagtagag-----tag |
53174121 |
T |
 |
| Q |
214 |
actagccccacttttga |
230 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
53174120 |
actagccccacttttga |
53174104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University