View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8518A_low_330 (Length: 229)
Name: NF8518A_low_330
Description: NF8518A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8518A_low_330 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 13293092 - 13292862
Alignment:
| Q |
1 |
tttggccttgcgaccactcaggttagaggttatttccaggttaaggcatatcaaacaatttcgatgtttatgttaaagaagacaattttagtactgaaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13293092 |
tttggccttgcgaccactcaggttagaggttatttccaggttaaggcatatcaaacaatttcgatgtttatgttaaagaagacaattttagtactgaaaa |
13292993 |
T |
 |
| Q |
101 |
tatatacaagtaaccagtgattcatattttca------annnnnnnaacaagactaggctcttaattggaatcatatgaagttgttaaa-aactttagaa |
193 |
Q |
| |
|
|||||||||||||||||||||||||||| | | || |||||||||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
13292992 |
tatatacaagtaaccagtgattcatattattattatttttttttttaataagactaggctcttaattggaatcatatgaagttcttaaacaactttagaa |
13292893 |
T |
 |
| Q |
194 |
tataggaattctactagtatatgaaagggtt |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
13292892 |
tataggaattctactagtatatgaaagggtt |
13292862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University