View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8518A_low_353 (Length: 226)
Name: NF8518A_low_353
Description: NF8518A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8518A_low_353 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 7 - 226
Target Start/End: Original strand, 26908363 - 26908582
Alignment:
| Q |
7 |
tcaacaagctatgttccgatcggaggaagagtttcagtcgttgatggaactcggcggcgcgtcgttcaacggagagatgaatctgaacggtaattcactt |
106 |
Q |
| |
|
||||||||||||||| || ||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
26908363 |
tcaacaagctatgtttcgtgcggaggaagagtttcggtcgttgatggaactcggtggcgcgtcgttcaacggagagatgaatctgaactgtaattcactt |
26908462 |
T |
|
| Q |
107 |
tatgaaacaaacgatgaggtggatgaagatgaggaagcggagattgacggtgatgaggatttaattccggtggcgaaagcggttgttgattataacgtgg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| ||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26908463 |
tatgaaacaaacgatgaggtggatgaagatgaagaagaggagattgatggtgatgaggatttgattccggtggcgaaagcggttgttgattataacgtgg |
26908562 |
T |
|
| Q |
207 |
tgattgacgcgcttcctccg |
226 |
Q |
| |
|
|||| ||||||||||||||| |
|
|
| T |
26908563 |
tgatcgacgcgcttcctccg |
26908582 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University