View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8518A_low_355 (Length: 226)
Name: NF8518A_low_355
Description: NF8518A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8518A_low_355 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 1 - 93
Target Start/End: Original strand, 31160428 - 31160520
Alignment:
| Q |
1 |
catcatcaatgacccagtttccgtgagaataatcacatggttgttgtagagaaagtgatagtgtccatagaaatgctgaagctagtagcagaa |
93 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31160428 |
catcatcattgacccagtttccttgagaataatcacatggttgttgtagagaaagtgatagtgtccatagaaatgctgaagctagtagcagaa |
31160520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University