View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8518A_low_365 (Length: 223)
Name: NF8518A_low_365
Description: NF8518A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8518A_low_365 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 21 - 205
Target Start/End: Complemental strand, 52445093 - 52444909
Alignment:
| Q |
21 |
tgcagaaccaagttttgaatctgcagcagcaagcactcactgaagatgcggtgagaggcctctttgccagcttagatgggaggctccatactactttcac |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| | |
|
|
| T |
52445093 |
tgcagaaccaagttttgaatctgcagcagcaagcactcactgaagatgcggtgagaggcctctttgccagcttagatgggaggctccatgctactttcgc |
52444994 |
T |
|
| Q |
121 |
gcagctctatgcctttttgcatgagaggctaccaggaggggagggtgttgcgggtgttgtgggagatgctccttgaggtgttcat |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52444993 |
gcagctctatgcctttttgcatgagaggctaccaggaggggagggtgttgcgggtgttgtgggagatgctccttgaggtgttcat |
52444909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University