View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8518A_low_368 (Length: 222)
Name: NF8518A_low_368
Description: NF8518A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8518A_low_368 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 2 - 222
Target Start/End: Original strand, 3271724 - 3271944
Alignment:
| Q |
2 |
actgatatgaatagtttattactatcatttatggtatcatattcaatttgtaatggtattgaaatccaatctggacctctgtgaatgatcaatatatact |
101 |
Q |
| |
|
||||| |||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
3271724 |
actgacatgaatagttcattactatcatttatggtatcctattcaatttgtaatggtattgaaatccaatctggagctctgtgaatgatcaatatatact |
3271823 |
T |
|
| Q |
102 |
cttccatcacatagagacaattgtttaagacattgaatttaagcagatgttctacaatttggacaaacggtgaatgcatggaacaaatgttaaaaacaaa |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
3271824 |
cttccatcacatagagacaattgtttaagacattgaatttaagcagatgttctaacatttggacaaacggtgaatacatggaacaaatgttaaaaacaaa |
3271923 |
T |
|
| Q |
202 |
cacaaaacgctatgctgagct |
222 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
3271924 |
cacaaaacgctatgctgagct |
3271944 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University