View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8518A_low_391 (Length: 216)
Name: NF8518A_low_391
Description: NF8518A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8518A_low_391 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 25 - 130
Target Start/End: Complemental strand, 8638041 - 8637936
Alignment:
| Q |
25 |
gactgattgcaatgaagtagtgcatctttatgagttcattgtcgttcttggnnnnnnnnaacaggttgtcgttgttctttgcttaatcaaattatatgcc |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
8638041 |
gactgattgcaatgaagtagtgcatctttatgagttcattgtcgttcttggttttttttaacaggttgtcgttgttctttgcgtaatcaaattatatgcc |
8637942 |
T |
|
| Q |
125 |
tatata |
130 |
Q |
| |
|
|||||| |
|
|
| T |
8637941 |
tatata |
8637936 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 61; Significance: 2e-26; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 129 - 197
Target Start/End: Original strand, 35111709 - 35111777
Alignment:
| Q |
129 |
tatatagcttgacgagtcccaattgaaaagggcagcttctagaaaatttaacttcataagccctcaagt |
197 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
35111709 |
tatatagcttgatgagtcccaattgaaaagggcaacttctagaaaatttaacttcataagccctcaagt |
35111777 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000002; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 28 - 75
Target Start/End: Complemental strand, 6757783 - 6757736
Alignment:
| Q |
28 |
tgattgcaatgaagtagtgcatctttatgagttcattgtcgttcttgg |
75 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||||||||| |||||||| |
|
|
| T |
6757783 |
tgattgcaatgaaatagtgcacctttatgagttcattgtagttcttgg |
6757736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 129 - 185
Target Start/End: Complemental strand, 6757716 - 6757660
Alignment:
| Q |
129 |
tatatagcttgacgagtcccaattgaaaagggcagcttctagaaaatttaacttcat |
185 |
Q |
| |
|
|||||||||||| ||||||||||||| || || | |||||| ||||||||||||||| |
|
|
| T |
6757716 |
tatatagcttgatgagtcccaattgagaaaggtaacttctataaaatttaacttcat |
6757660 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University