View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8518A_low_416 (Length: 203)
Name: NF8518A_low_416
Description: NF8518A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8518A_low_416 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 64 - 197
Target Start/End: Original strand, 23085717 - 23085850
Alignment:
| Q |
64 |
cttattctatggtactgtattgggtaatttaagtttaacaacatcaggattcacgacaaactcagagtaaaaatagaagtcggtataattggtttgcgag |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
23085717 |
cttattctatggtactgtattgggtaatttaagtttaataacatcaggattcacgacaaactcaaagtaaaaatagaagtcggtataattggtttgcgat |
23085816 |
T |
|
| Q |
164 |
gaaaaacgcccgtactaaaaagcgatctcaatcc |
197 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |
|
|
| T |
23085817 |
gaaaaacgaccgtactaaaaagcgatctcaatcc |
23085850 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University