View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8518A_low_420 (Length: 201)
Name: NF8518A_low_420
Description: NF8518A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8518A_low_420 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 92; Significance: 7e-45; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 1 - 104
Target Start/End: Complemental strand, 35489857 - 35489754
Alignment:
| Q |
1 |
tgatcttctcttagtctttatatgtctatatgttgcggcatttgcatggtcttggggtgcgttgggatggttagttcctagtgaaatatgctctcttgat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
35489857 |
tgatcttctcttagtctttatatgtctatatgttgcggcatttgcatggtcttggggtgcgctgggatggttagttcccagtgaaatatgctctcttgaa |
35489758 |
T |
|
| Q |
101 |
gtcc |
104 |
Q |
| |
|
|||| |
|
|
| T |
35489757 |
gtcc |
35489754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 48; Significance: 1e-18; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 5 - 96
Target Start/End: Original strand, 14233090 - 14233181
Alignment:
| Q |
5 |
cttctcttagtctttatatgtctatatgttgcggcatttgcatggtcttggggtgcgttgggatggttagttcctagtgaaatatgctctct |
96 |
Q |
| |
|
|||||||| ||||||| ||| |||||||||||||||||||||||||||||| | ||||| |||||||| ||||||||||||||| |||| |
|
|
| T |
14233090 |
cttctcttgttctttatttgtgcatatgttgcggcatttgcatggtcttggggaccattgggttggttagtgcctagtgaaatatgcgctct |
14233181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 5 - 96
Target Start/End: Original strand, 14242764 - 14242855
Alignment:
| Q |
5 |
cttctcttagtctttatatgtctatatgttgcggcatttgcatggtcttggggtgcgttgggatggttagttcctagtgaaatatgctctct |
96 |
Q |
| |
|
|||||||| ||||||| ||| |||||||||||||||||||||||||||||| | ||||| |||||||| ||||||||| ||||| |||| |
|
|
| T |
14242764 |
cttctcttgttctttatttgtgcatatgttgcggcatttgcatggtcttggggaccattgggttggttagtgcctagtgaagtatgcgctct |
14242855 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University