View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8518A_low_58 (Length: 387)
Name: NF8518A_low_58
Description: NF8518A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8518A_low_58 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 352; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 352; E-Value: 0
Query Start/End: Original strand, 10 - 381
Target Start/End: Original strand, 42484709 - 42485080
Alignment:
| Q |
10 |
atgatccaggagatcaccaccaaaacctcatctgccgctgcctcactctctccgacacccacctcgcctgtggcttcgtcgacggtagtgtccgactctt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
42484709 |
atgatccaggagatcaccaccaaaacctcatctgccgctgcctcactctctccgacacccaccttgcctgtggcttcgtcgacggtagtgtccgactctt |
42484808 |
T |
|
| Q |
110 |
cgatctccacaccggtgcacatgttagcacattttggtccaaccatggtcttctatttggcccgttctcacaatccgtttcgggaattttaattggaagc |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
42484809 |
cgatctccacaccggtgcacatgttagcacattttggtccaaccatggtcttctatttggcccgttctcacaatccgtttcaggaattgtaattggaagc |
42484908 |
T |
|
| Q |
210 |
tctactctcgccttcgcaagattagatggagatgtctacattgctattataaatgggcctggaccaatacccgggcccattcctgcacgacgggcaatta |
309 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42484909 |
tctactctcgccttcgcgagattagatggagatgtctacattgctattataaatgggcctggaccaatacccgggcccattcctgcacgacgggcaatta |
42485008 |
T |
|
| Q |
310 |
ttggtgatgttgttaataacggagtattagtagaatttgccggctctagtcgatggtgggttggtttatatg |
381 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
42485009 |
ttggtgatgttgttaataacggagtattagtagaatttgccggctctagtcgttggtgggttggtttatatg |
42485080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University