View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8518A_low_59 (Length: 386)
Name: NF8518A_low_59
Description: NF8518A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8518A_low_59 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 200; Significance: 1e-109; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 156 - 380
Target Start/End: Original strand, 6307751 - 6307981
Alignment:
| Q |
156 |
caaaatatctaaacatagcccaggtcttaaatcagtatcttatcctgtctagtttaattgtcgacatagtttatgatgtcctcgt------gggcacata |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
6307751 |
caaaatatctaaacatagcccaggtcttaaatcagtatcttatcctgtctagtttaattgtcgacatagtttatgatgtcctcgtggtcgtgggcacata |
6307850 |
T |
|
| Q |
250 |
tggtgcaaattaggccaaacaagataccagaatgcagaaccataacttttatggtgaatgacatctcaactatctatcacttgtggaattatcacttacg |
349 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
6307851 |
tggtgcaaatttggccaaacaagataccagaatgcagaaccataacttttatggtgaatgacatctcaactatctatcacttgtggacttatcacttacg |
6307950 |
T |
|
| Q |
350 |
cttggtatattggcctttataatatgagaag |
380 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
6307951 |
cttggtatattggcctttataatatgagaag |
6307981 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 20 - 94
Target Start/End: Original strand, 6307615 - 6307689
Alignment:
| Q |
20 |
cttctaatattacacctctttattatttgattaaatcaaaatatataacataatcattaaaatttgccaaaaccg |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
6307615 |
cttctaatattacacctctttattatttgattaaatcaaaatatataacataatgattaaaatttgccaaaaccg |
6307689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University