View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8518A_low_78 (Length: 363)
Name: NF8518A_low_78
Description: NF8518A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8518A_low_78 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 294; Significance: 1e-165; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 22 - 357
Target Start/End: Original strand, 38831072 - 38831396
Alignment:
| Q |
22 |
ttaagtaaaagggtttgtaactaattaacaaacatataccaaattaaatagcaattatatatatagtaactcaccttaacttttctcttcccatgaggat |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
38831072 |
ttaagtaaaagggtttgtaactaattaacaaacatataccaaattaaatagcaattat-----------ctcaccttcacttttctcttcccatgaggat |
38831160 |
T |
|
| Q |
122 |
tattctttgattgagatgatgattttcttcctttctcaccttccttaggcaatggattcggcacaacggattcatctcttttgctaattatctcttccac |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38831161 |
tattctttgattgagatgatgattttcttcctttctcaccttccttaggcaatggattcggcacaacggattcatctcttttgctaattatctcttccac |
38831260 |
T |
|
| Q |
222 |
acgactcgaacttgaatctgaagaataaactactttctcttcatcttgtaattttctctcaatactaaccatattcccatcattacaagatttgctattt |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38831261 |
acgactcgaacttgaatctgaagaataaactactttctcttcatcttgtaattttctctcaatactaaccatattcccatcattacaagatttgctattt |
38831360 |
T |
|
| Q |
322 |
gcacccgacgaatttatatccgattcctcaccgctg |
357 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
38831361 |
gcacccgacgaatttatatccgattcctcaccgctg |
38831396 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University