View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8518A_low_89 (Length: 351)
Name: NF8518A_low_89
Description: NF8518A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8518A_low_89 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 319; Significance: 1e-180; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 319; E-Value: 1e-180
Query Start/End: Original strand, 15 - 345
Target Start/End: Original strand, 1329756 - 1330086
Alignment:
| Q |
15 |
tgatagagtgacaactgaagaacatggggacaaacttgccttagctttatttgatggggctgcaccagcaacaagtgaaggtggaataaaagcacttcca |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1329756 |
tgatagagtgacaactgaagaacatggggacaaactagccttagctttatttgatggggctgcaccagcaacaagtgaaggtggaataaaagcacttcca |
1329855 |
T |
 |
| Q |
115 |
tggcatgcatttgacgagagtgcagattgggaaacagcgttggtacaatcaaccagccacttaggaaaccagcagcctgcattaggtggaggctttgata |
214 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1329856 |
tggcatgcatttgatgagagtgcagattgggaaacagcgttggtacaatcaaccagccacttaggaaaccagcagcctgcattaggtggaggctttgata |
1329955 |
T |
 |
| Q |
215 |
cattattgttggatggtatgtataaacaaggagaaatgaatgcagccatgcaaggagtgggatatggttgcagtggaagtgctagcagtgtagcacttgg |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
1329956 |
cattattgttggatggtatgtataaacaaggagaaatgaatgcagccatgcaaggagtgggatatggtggcagtggaagtgctagcagtgtagcacttgg |
1330055 |
T |
 |
| Q |
315 |
ttcagccggaaggccagcaatgctagcattg |
345 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
1330056 |
ttcagccggaaggccagcaatgctagcattg |
1330086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University