View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8518_low_12 (Length: 262)

Name: NF8518_low_12
Description: NF8518
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8518_low_12
NF8518_low_12
[»] chr5 (5 HSPs)
chr5 (1-246)||(9897892-9898137)
chr5 (8-243)||(9878048-9878285)
chr5 (112-236)||(9908296-9908420)
chr5 (107-236)||(9863898-9864027)
chr5 (29-94)||(14817017-14817082)
[»] chr6 (2 HSPs)
chr6 (14-77)||(6294558-6294622)
chr6 (8-55)||(34625729-34625777)
[»] chr8 (2 HSPs)
chr8 (32-77)||(29072508-29072553)
chr8 (29-77)||(14227195-14227243)
[»] chr4 (2 HSPs)
chr4 (24-76)||(7367527-7367579)
chr4 (29-76)||(56049851-56049898)
[»] chr1 (1 HSPs)
chr1 (25-55)||(45660803-45660833)
[»] chr3 (2 HSPs)
chr3 (29-57)||(46191383-46191411)
chr3 (26-62)||(52066967-52067003)


Alignment Details
Target: chr5 (Bit Score: 246; Significance: 1e-136; HSPs: 5)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 1 - 246
Target Start/End: Original strand, 9897892 - 9898137
Alignment:
Q  1 cgcaggcgattatattcaattaatcatattctcaaattattattggtgtcgatgtgtgagtgccgtgtccggtgtctatatcagtgcttcatagagtaaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  9897892 cgcaggcgattatattcaattaatcatattctcaaattattattggtgtcgatgtgtgagtgccgtgtccggtgtctatatcagtgcttcatagagtaaa 9897991  T
Q  101 gtataaaaatgtgaataggatgatgatgccttactgccatagagaaagatgcatatgagagtgcattactgcgacaaacatcacgtgcaccaaatggacc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  9897992 gtataaaaatgtgaataggatgatgatgccttactgccatagagaaagatgcatatgagagtgcattactgcgacaaacatcacgtgcaccaaatggacc 9898091  T
Q  201 tcctttctcatcacatattgctgggatgattacaattggcaagttt 246  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
T  9898092 tcctttctcatcacatattgctgggatgattacaattggcaagttt 9898137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 8 - 243
Target Start/End: Original strand, 9878048 - 9878285
Alignment:
Q  8 gattatattcaattaat-catattctcaaattattattggtgtcgatgtgtgagtgccgtgtccggtgtctatat--cagtgcttcatagagtaaagtat 104  Q
    ||||| ||||||||||| |||||||||||||||||||||||||||| |||| |||| | ||| |||||||||| |  ||||||||||||||| |||||||    
T  9878048 gattacattcaattaattcatattctcaaattattattggtgtcgacgtgtcagtgtcttgttcggtgtctatgtgtcagtgcttcatagagcaaagtat 9878147  T
Q  105 aaaaatgtgaataggatgatgatgccttactgccatagagaaagatgcatatgagagtgcattactgcgacaaacatcacgtgcaccaaatggacctcct 204  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||| | || ||||| |||||||||||||||||||||    
T  9878148 aaaaatgtga-taggatgatgatgccttactgccatagagaaagatgcatatgagagtgcattgctgtggcatacatcgcgtgcaccaaatggacctcct 9878246  T
Q  205 ttctcatcacatattgctgggatgattacaattggcaag 243  Q
    ||||||| ||||||||||||||| ||||||| |||||||    
T  9878247 ttctcattacatattgctgggataattacaactggcaag 9878285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 112 - 236
Target Start/End: Original strand, 9908296 - 9908420
Alignment:
Q  112 tgaataggatgatgatgccttactgccatagagaaagatgcatatgagagtgcattactgcgacaaacatcacgtgcaccaaatggacctcctttctcat 211  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| | |||||||| ||||||||||| ||||||||||||||||    
T  9908296 tgaataggatgatgatgccttactgccatagagaaagatgcatacgagagtgcattactgtggcaaacatcgcgtgcaccaaacggacctcctttctcat 9908395  T
Q  212 cacatattgctgggatgattacaat 236  Q
     ||||||||||||||| ||||||||    
T  9908396 tacatattgctgggataattacaat 9908420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 107 - 236
Target Start/End: Complemental strand, 9864027 - 9863898
Alignment:
Q  107 aaatgtgaataggatgatgatgccttactgccatagagaaagatgcatatgagagtgcattactgcgacaaacatcacgtgcaccaaatggacctccttt 206  Q
    |||| ||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||| | |||||||| ||||| ||||| |||||||||||    
T  9864027 aaatatgaataggatgatgatgccttactgccatggagaaagatgcatacgagagtgcattactgtggcaaacatcgcgtgccccaaacggacctccttt 9863928  T
Q  207 ctcatcacatattgctgggatgattacaat 236  Q
    ||||| ||||||||| ||||||||||||||    
T  9863927 ctcattacatattgcagggatgattacaat 9863898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 29 - 94
Target Start/End: Complemental strand, 14817082 - 14817017
Alignment:
Q  29 ttctcaaattattattggtgtcgatgtgtgagtgccgtgtccggtgtctatatcagtgcttcatag 94  Q
    |||||||||||||| ||||||| |||| | ||||||||||||| |||||||  | |||||||||||    
T  14817082 ttctcaaattattactggtgtcaatgtatcagtgccgtgtccgatgtctatgacggtgcttcatag 14817017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 37; Significance: 0.000000000006; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 14 - 77
Target Start/End: Original strand, 6294558 - 6294622
Alignment:
Q  14 attcaattaat-catattctcaaattattattggtgtcgatgtgtgagtgccgtgtccggtgtct 77  Q
    ||||||||||| ||| |||||||||||||||  |||| ||||||||||||||||||| |||||||    
T  6294558 attcaattaattcattttctcaaattattatcagtgttgatgtgtgagtgccgtgtctggtgtct 6294622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 8 - 55
Target Start/End: Complemental strand, 34625777 - 34625729
Alignment:
Q  8 gattatattcaattaat-catattctcaaattattattggtgtcgatgt 55  Q
    ||||| ||||||||||| ||| ||||||||||||||| |||||||||||    
T  34625777 gattacattcaattaattcattttctcaaattattatcggtgtcgatgt 34625729  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 34; Significance: 0.0000000004; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 32 - 77
Target Start/End: Original strand, 29072508 - 29072553
Alignment:
Q  32 tcaaattattattggtgtcgatgtgtgagtgccgtgtccggtgtct 77  Q
    |||||||||||| |||||||| ||||||||| ||||||||||||||    
T  29072508 tcaaattattatcggtgtcgacgtgtgagtgtcgtgtccggtgtct 29072553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 29 - 77
Target Start/End: Complemental strand, 14227243 - 14227195
Alignment:
Q  29 ttctcaaattattattggtgtcgatgtgtgagtgccgtgtccggtgtct 77  Q
    ||||||||||||||||||||| || |||| |||| ||||||| ||||||    
T  14227243 ttctcaaattattattggtgttgacgtgtcagtgacgtgtccagtgtct 14227195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 76
Target Start/End: Complemental strand, 7367579 - 7367527
Alignment:
Q  24 tcatattctcaaattattattggtgtcgatgtgtgagtgccgtgtccggtgtc 76  Q
    |||| |||||||||||||||||||||| |||||| |||| ||||| |||||||    
T  7367579 tcattttctcaaattattattggtgtctatgtgttagtgtcgtgttcggtgtc 7367527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 29 - 76
Target Start/End: Complemental strand, 56049898 - 56049851
Alignment:
Q  29 ttctcaaattattattggtgtcgatgtgtgagtgccgtgtccggtgtc 76  Q
    ||||||||||||||| |||||||||||||  ||| |||||||||||||    
T  56049898 ttctcaaattattatcggtgtcgatgtgtccgtgtcgtgtccggtgtc 56049851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 25 - 55
Target Start/End: Original strand, 45660803 - 45660833
Alignment:
Q  25 catattctcaaattattattggtgtcgatgt 55  Q
    |||||||||||||||||||||||||||||||    
T  45660803 catattctcaaattattattggtgtcgatgt 45660833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 29; Significance: 0.0000004; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 29 - 57
Target Start/End: Original strand, 46191383 - 46191411
Alignment:
Q  29 ttctcaaattattattggtgtcgatgtgt 57  Q
    |||||||||||||||||||||||||||||    
T  46191383 ttctcaaattattattggtgtcgatgtgt 46191411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 26 - 62
Target Start/End: Complemental strand, 52067003 - 52066967
Alignment:
Q  26 atattctcaaattattattggtgtcgatgtgtgagtg 62  Q
    ||||||| ||||||||||||||||||| |||||||||    
T  52067003 atattcttaaattattattggtgtcgacgtgtgagtg 52066967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University