View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8519_high_10 (Length: 276)

Name: NF8519_high_10
Description: NF8519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8519_high_10
NF8519_high_10
[»] chr6 (2 HSPs)
chr6 (65-262)||(13115138-13115334)
chr6 (6-41)||(13115355-13115390)


Alignment Details
Target: chr6 (Bit Score: 134; Significance: 8e-70; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 134; E-Value: 8e-70
Query Start/End: Original strand, 65 - 262
Target Start/End: Complemental strand, 13115334 - 13115138
Alignment:
65 caagtgggagttttaggtatattcctttgcccccaggcgtaaatgtgcggcgaggtctataaagagggagttttagcacaagtttgaatgttgaaaaatg 164  Q
    ||||||||||||| |||||  ||||||||||||  |||| ||||  ||| ||||||||||||||||||||||||||||| |||||||||||| |||||||    
13115334 caagtgggagtttaaggtacgttcctttgcccct-ggcgcaaattcgcgacgaggtctataaagagggagttttagcaccagtttgaatgttaaaaaatg 13115236  T
165 ctttagaagatatggaatgaagattgtcgatgaataaggctttgaagacatcataagatgggaaaattttgtcccaagatcaatttgcataaagaaaa 262  Q
    |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| | |||||||||||||||||||||| ||||||||||||    
13115235 ctttagaagatatggaatgaagattgtcaatgaataaggctttgaagacatcataagatgcggaaattttgtcccaagatcaattcgcataaagaaaa 13115138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 6 - 41
Target Start/End: Complemental strand, 13115390 - 13115355
Alignment:
6 aaagtatattattgccacttaacataactatttaat 41  Q
    |||||||||||||||||||||||||||||||| |||    
13115390 aaagtatattattgccacttaacataactattgaat 13115355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University