View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8519_high_10 (Length: 276)
Name: NF8519_high_10
Description: NF8519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8519_high_10 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 134; Significance: 8e-70; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 134; E-Value: 8e-70
Query Start/End: Original strand, 65 - 262
Target Start/End: Complemental strand, 13115334 - 13115138
Alignment:
| Q |
65 |
caagtgggagttttaggtatattcctttgcccccaggcgtaaatgtgcggcgaggtctataaagagggagttttagcacaagtttgaatgttgaaaaatg |
164 |
Q |
| |
|
||||||||||||| ||||| |||||||||||| |||| |||| ||| ||||||||||||||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
13115334 |
caagtgggagtttaaggtacgttcctttgcccct-ggcgcaaattcgcgacgaggtctataaagagggagttttagcaccagtttgaatgttaaaaaatg |
13115236 |
T |
|
| Q |
165 |
ctttagaagatatggaatgaagattgtcgatgaataaggctttgaagacatcataagatgggaaaattttgtcccaagatcaatttgcataaagaaaa |
262 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| | |||||||||||||||||||||| |||||||||||| |
|
|
| T |
13115235 |
ctttagaagatatggaatgaagattgtcaatgaataaggctttgaagacatcataagatgcggaaattttgtcccaagatcaattcgcataaagaaaa |
13115138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 6 - 41
Target Start/End: Complemental strand, 13115390 - 13115355
Alignment:
| Q |
6 |
aaagtatattattgccacttaacataactatttaat |
41 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| |
|
|
| T |
13115390 |
aaagtatattattgccacttaacataactattgaat |
13115355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University