View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8519_high_13 (Length: 228)
Name: NF8519_high_13
Description: NF8519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8519_high_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 66; Significance: 3e-29; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 111 - 200
Target Start/End: Original strand, 15390456 - 15390545
Alignment:
| Q |
111 |
cactagaaatttggtaagaacggagtgaaccaataaagtttttaataacaaactagtacttggacctgtgcaacttaactatatcattga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||| || |||||| |||||||||||||||| |
|
|
| T |
15390456 |
cactagaaatttggtaagaacggagtgagccactaaagtttttaataacaaactagtacttgatcccgtgcaagttaactatatcattga |
15390545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 1 - 85
Target Start/End: Original strand, 15390382 - 15390466
Alignment:
| Q |
1 |
aatccattcctgaaattagttaggggctatcgtaagaattaaatgttcatttgttaatagattaagattgaacacactagaaatt |
85 |
Q |
| |
|
|||||||||| || ||||||||||||||||||||||||| |||||||||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
15390382 |
aatccattccccaagttagttaggggctatcgtaagaatttaatgttcatttgctaagagattaagattgaacacactagaaatt |
15390466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University