View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8519_high_7 (Length: 319)
Name: NF8519_high_7
Description: NF8519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8519_high_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 9 - 248
Target Start/End: Complemental strand, 36102522 - 36102280
Alignment:
| Q |
9 |
gattatactattcattatttgcaacctgtggcaggtgggccgattatcatttatcattatgtaatcactaggtcactatttacataatgcagacggatct |
108 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36102522 |
gattatgctattcattatttgcaacctgtggcaggtgggccgattatcatttatcattatgtaatcactaggtcactatttacataatgcagacggatct |
36102423 |
T |
|
| Q |
109 |
ttatggcatatagttgccactaaccaaaacttctgctccttattgatatgcattcattaggtcatcgttccccttttgggtccttgtataattgtattat |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36102422 |
ttatggcatatagttgccactaaccaaaacttctgctccttattgatatgcattcattaggtcatcgttccccttttgggtccttgtataattgtattat |
36102323 |
T |
|
| Q |
209 |
aatgatactagtta---aaagattcaccaaaaatataaataga |
248 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
36102322 |
aatgatactagttaaagaaagattcaccaaaaatataaataga |
36102280 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University