View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8519_low_21 (Length: 221)
Name: NF8519_low_21
Description: NF8519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8519_low_21 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 2 - 221
Target Start/End: Original strand, 10598831 - 10599050
Alignment:
| Q |
2 |
ttcacacctgttttgagcatatcatagaacaattctagtgcttttgtagcaaacccatgttttgcaaaaccatttatgatagaggtccaagttatgacat |
101 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10598831 |
ttcacacctgtttcaagcatattatagaacaattctagtgcttttgaagcaaatccatgttttgcaaaaccatttatgatagaggtccaagttatgacat |
10598930 |
T |
 |
| Q |
102 |
tgcgatcttccatgtcattaaagacctgtaaagcagcttctttgtttccacacttagaatacatagagatcaaagcattattaacacttaggtcagtccg |
201 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
10598931 |
tgcaatcttccatgtcattaaagacctgtaaagcagcttctttgtttccacacttggaatacatagagatcaaagcattattaacacttaagtcagtccg |
10599030 |
T |
 |
| Q |
202 |
aaatcccatcttcaccacca |
221 |
Q |
| |
|
|||||| ||||| ||||||| |
|
|
| T |
10599031 |
aaatccaatcttaaccacca |
10599050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University