View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8519_low_9 (Length: 344)
Name: NF8519_low_9
Description: NF8519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8519_low_9 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 14 - 344
Target Start/End: Complemental strand, 10599583 - 10599253
Alignment:
| Q |
14 |
agaggctaggaaagtgtttgatggtatgagagagcataatgtgatgtcgtggacggcacttattaatggatatgtaagaggcggtggtgggtatgaaagg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||| |||||||||||||| ||||||||||||| |||||| || |
|
|
| T |
10599583 |
agaggctaggaaagtgtttgatggtatgagggagcataatgtgatgtcgtggacggctcttgttaatggatatgtacgaggcggtggtggatatgaacgg |
10599484 |
T |
 |
| Q |
114 |
gaagctatgagattgtttagcgatatgttgcttcagggttgtgttgcgccaaattgctttacgttttctggtgttcttaaggcttgtgcgagtcttccta |
213 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||||||||| |||||||||| || ||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
10599483 |
gaagctatgagaatgtttagtaatatgttgcttcagggtggtgttgcgccgaactgctttacgttctccggtgttcttaaggcttgtgcgagtcttcctg |
10599384 |
T |
 |
| Q |
214 |
attttgattttggtgaacaagttcacgggcaaacgattaaattaggtctttctgcgattgattgtgtagggaatggtcttgttagtgtgtatgcaaggtc |
313 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
10599383 |
attttgattttggtgaacaggttcatgggcaaacgattaaattaggtctttctgcaattgattgtgtagggaatggtcttgttagtgtgtatgcaaagtc |
10599284 |
T |
 |
| Q |
314 |
tgggagaatggaaggtgctcgcaagtgtttt |
344 |
Q |
| |
|
||| ||||||||| |||||||||||||||| |
|
|
| T |
10599283 |
tggaagaatggaatctgctcgcaagtgtttt |
10599253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University