View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8520_high_3 (Length: 248)

Name: NF8520_high_3
Description: NF8520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8520_high_3
NF8520_high_3
[»] chr5 (1 HSPs)
chr5 (2-248)||(1903679-1903925)


Alignment Details
Target: chr5 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 2 - 248
Target Start/End: Original strand, 1903679 - 1903925
Alignment:
2 gactttggtgttgtggtttttagatggctggaaagaaaatcaaactgagtttcttttggcggaggtggtggcaacctttgtatcaatgatactgaaaact 101  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1903679 gactttggtgttgtggtttttagatggctggaaagaaaatcaaactgagtttcttttggcggaggtggtggcaacctttgtatcaatgatactgaaaact 1903778  T
102 ggaatattggattgatatggtaagggaagccaaggttcgggaggttggttactggtagaaatttcagttttaatgggaaaaaaggggtgtctggaagcgt 201  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1903779 ggaatattggattgatatggtaatggaagccaaggttcgggaggttggttactggtagaaatttcagttttaatgggaaaaaaggggtgtctggaagcgt 1903878  T
202 agatgtcgaattttaattacagttgaaaaatggctttctcgagtttg 248  Q
    ||||||||| |||||||||||||||||||||||||||||| ||||||    
1903879 agatgtcgagttttaattacagttgaaaaatggctttctctagtttg 1903925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University