View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8520_high_5 (Length: 240)

Name: NF8520_high_5
Description: NF8520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8520_high_5
NF8520_high_5
[»] chr4 (2 HSPs)
chr4 (15-95)||(35499563-35499643)
chr4 (162-219)||(35499161-35499218)


Alignment Details
Target: chr4 (Bit Score: 69; Significance: 4e-31; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 15 - 95
Target Start/End: Complemental strand, 35499643 - 35499563
Alignment:
15 gaagacgccggttaacacaaaccatttgtttattcatcaaagagcaaattgacatatgcgaggcgcaatcaggaacgttgt 95  Q
    |||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
35499643 gaagacgccgattaacataaaccatttgtttattcatcaaagagcaaattgacatatgcaaggcgcaatcaggaacgttgt 35499563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 162 - 219
Target Start/End: Complemental strand, 35499218 - 35499161
Alignment:
162 ttaactattaattgatttaaacgattattgaatgatatcgtttcgatcatactggtca 219  Q
    ||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||    
35499218 ttaactattaattgatttaaacgattattgactgatatcgtttcgaccatactggtca 35499161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University