View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8520_high_5 (Length: 240)
Name: NF8520_high_5
Description: NF8520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8520_high_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 69; Significance: 4e-31; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 15 - 95
Target Start/End: Complemental strand, 35499643 - 35499563
Alignment:
| Q |
15 |
gaagacgccggttaacacaaaccatttgtttattcatcaaagagcaaattgacatatgcgaggcgcaatcaggaacgttgt |
95 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
35499643 |
gaagacgccgattaacataaaccatttgtttattcatcaaagagcaaattgacatatgcaaggcgcaatcaggaacgttgt |
35499563 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 162 - 219
Target Start/End: Complemental strand, 35499218 - 35499161
Alignment:
| Q |
162 |
ttaactattaattgatttaaacgattattgaatgatatcgtttcgatcatactggtca |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
35499218 |
ttaactattaattgatttaaacgattattgactgatatcgtttcgaccatactggtca |
35499161 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University