View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8520_low_12 (Length: 212)
Name: NF8520_low_12
Description: NF8520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8520_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 25 - 196
Target Start/End: Original strand, 52851421 - 52851592
Alignment:
| Q |
25 |
ttctctctccaaaaataagttgtcagatatggatgttcaaatatcaatactctttatatatttcattattctctatcccacgatgagtgtcacaaactat |
124 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52851421 |
ttctctctccaaaaagaagttgtctcggatggatgttcaaatatcactactctttatatatttcattattctctatcccacgatgagtgtcacaaactat |
52851520 |
T |
 |
| Q |
125 |
ataaattgatgaatcttgaaaagatgaaaatgacacaaaaggatcattttccgatttttcatgtatcaaatg |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52851521 |
ataaattgatgaatcttgaaaagatgaaaatgacacaaaaggatcattttccgatttttcatgtatcaaatg |
52851592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University