View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8520_low_7 (Length: 248)
Name: NF8520_low_7
Description: NF8520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8520_low_7 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 2 - 248
Target Start/End: Original strand, 1903679 - 1903925
Alignment:
| Q |
2 |
gactttggtgttgtggtttttagatggctggaaagaaaatcaaactgagtttcttttggcggaggtggtggcaacctttgtatcaatgatactgaaaact |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1903679 |
gactttggtgttgtggtttttagatggctggaaagaaaatcaaactgagtttcttttggcggaggtggtggcaacctttgtatcaatgatactgaaaact |
1903778 |
T |
 |
| Q |
102 |
ggaatattggattgatatggtaagggaagccaaggttcgggaggttggttactggtagaaatttcagttttaatgggaaaaaaggggtgtctggaagcgt |
201 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1903779 |
ggaatattggattgatatggtaatggaagccaaggttcgggaggttggttactggtagaaatttcagttttaatgggaaaaaaggggtgtctggaagcgt |
1903878 |
T |
 |
| Q |
202 |
agatgtcgaattttaattacagttgaaaaatggctttctcgagtttg |
248 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
1903879 |
agatgtcgagttttaattacagttgaaaaatggctttctctagtttg |
1903925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University