View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8521A_high_21 (Length: 370)
Name: NF8521A_high_21
Description: NF8521A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8521A_high_21 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 130; Significance: 3e-67; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 130; E-Value: 3e-67
Query Start/End: Original strand, 105 - 241
Target Start/End: Complemental strand, 20489587 - 20489450
Alignment:
| Q |
105 |
atgaacctaaagaggaagcagtgagatattaatgggccatagtaaatcaatcctagtcaaaagaaattaccctccaagcaattacttttaatttgtt-aa |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
20489587 |
atgaacctaaagaggaagcagtgagatattaatgggccatagtaaatcaatcctagtcaaaagaaattaccctccaagcaattacttttaatttgttaaa |
20489488 |
T |
|
| Q |
204 |
agagtgactttgaagctctcaaaattatggtgggatct |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20489487 |
agagtgactttgaagctctcaaaattatggtgggatct |
20489450 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University