View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8521A_low_121 (Length: 298)
Name: NF8521A_low_121
Description: NF8521A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8521A_low_121 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 1 - 290
Target Start/End: Complemental strand, 44965115 - 44964826
Alignment:
| Q |
1 |
aaggaatggttctcaaaagggatatttcttgcaatctcttatcttttcgtgatttttctttgtgacccatgtctgtatagatgtggatttggcaacaatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44965115 |
aaggaatggttctcaaaagggatatttcttgcaatctcttatcttttcgtgatttttctttgtgacccatgtctgtatagatgtggatttggcaacaatg |
44965016 |
T |
 |
| Q |
101 |
aagctaaattaaaagtagcattgtttggagtatgggatagtgcaacatgaaagaaaaatatgttgtgttgtaatgtattgaatgtatcacatatgctatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44965015 |
aagctaaattaaaagtagcattgtttggagtatgggatagtgcaacatgaaagaaaaatatgttgtgttgtaatgtattgaatgtatcacatatgctatg |
44964916 |
T |
 |
| Q |
201 |
ttgttatccgcatgcaaaggatcaaattgatgtcctagaatagaatgctacgttattggtgcaagagcacctatgttgttggtctctggt |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
44964915 |
ttgttatccgcatgcaaaggatcaaattgatgtcctagaatagaatgctacgttattggttcaagagcacctatgttgttggtctctggt |
44964826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 40068446 - 40068400
Alignment:
| Q |
1 |
aaggaatggttctcaaaagggatatttcttgcaatctcttatctttt |
47 |
Q |
| |
|
|||||||||| |||||||| |||||||||||| |||||||||||||| |
|
|
| T |
40068446 |
aaggaatggtcctcaaaagcgatatttcttgcgatctcttatctttt |
40068400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University