View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8521A_low_127 (Length: 296)
Name: NF8521A_low_127
Description: NF8521A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8521A_low_127 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 19 - 296
Target Start/End: Complemental strand, 42235129 - 42234852
Alignment:
| Q |
19 |
ataatttacgttggtaattttactacacagaagtttcgtttgactgcgattgaaggatctgcatacacaggaacaaatggattgggtcaaactagtaagt |
118 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42235129 |
ataatttatgttagtaattttactacacagaagtttggtttgactgagattgaaggatctgcatacacaggaacaaatggattgggtcaaactagtaagt |
42235030 |
T |
 |
| Q |
119 |
gcttattgcatcaaatgtacagttttgggttgattctattctatggaagtgttttaagtttagggagcttgttgtttatttatgtagatgagagtcctgc |
218 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
42235029 |
gcttattgcaacaaatgtacagttttgggttgattctattctatggaagtgttttaagtttagggagcttattgtttatttatgtagatgagagtcctgc |
42234930 |
T |
 |
| Q |
219 |
caattgggaaaacgtgcttgaagggattcgcaaaatgatgtattcgataaacactaccggtgatcgggaagatgctga |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
42234929 |
caattgggaaaacgtgcttgaagggattcgcaaaatgatgtattcgatagacactaccggtgatcgggaagatgctga |
42234852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University