View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8521A_low_135 (Length: 291)
Name: NF8521A_low_135
Description: NF8521A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8521A_low_135 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 6 - 282
Target Start/End: Original strand, 51682395 - 51682671
Alignment:
| Q |
6 |
aaagaaaagatatatagtaccgttacagggcactatcagtatccctctcgtgttcagtagaatcagcaccaatgataatggaattgtactattaatctgt |
105 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51682395 |
aaagaaaagatatatagtaccgttacaaggcactatcagtatccctctcgtgttcagtagaatcagcaccaatgataatggaattgtactattaatctgt |
51682494 |
T |
|
| Q |
106 |
acaatagcatccatgaagccgatctattgtagaatataccgttattgcatagttgcatataaatgtaataacagatgcagcaaaatatggtgatattcat |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51682495 |
acaatagcatccatgaagccgatctattgtagaatataccgttattgcatagttgcatataaatgtaataacagatgcagcaaaatatggtgatattcat |
51682594 |
T |
|
| Q |
206 |
gtagacatttaaaaacctttagttcatttttctccatgactcattcaactacatcctcttccctaaatgatattatt |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51682595 |
gtagacatttaaaaacctttagttcatttttctccatgactcattcaactacatcctcttccctaaatgatattatt |
51682671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University