View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8521A_low_150 (Length: 280)
Name: NF8521A_low_150
Description: NF8521A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8521A_low_150 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 233; Significance: 1e-129; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 37 - 276
Target Start/End: Complemental strand, 13879675 - 13879435
Alignment:
| Q |
37 |
gatgatgatgatcttgttctctgggattttacggagactgaggagtctgtgattttgcggtcgaatcttgtcgctgacaacgtgaggaaggaagagattg |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13879675 |
gatgatgatgatcttgttctctgggattttacggagactgaggagtctgtgattttgcggtcgaatcttgtcgctgacaacgtgaggaaggaagagattg |
13879576 |
T |
|
| Q |
137 |
atgtctgtgttgatcacggtactctcaggattgaggatgttcttcccggtcgaaatctgttttcagtaacacttaacttg-aagggaagcactgcgactt |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
13879575 |
atgtctgtgttgatcacggtactctcaggattgaggatgttcttcccggtcgaaatctgttttcagtaacacttaacttgaaagggaagcactgcgactt |
13879476 |
T |
|
| Q |
236 |
tgttaacactaaagccaaaatgatagagaacaatttcattg |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13879475 |
tgttaacactaaagccaaaatgatagagaacaatttcattg |
13879435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 47 - 272
Target Start/End: Complemental strand, 13875448 - 13875222
Alignment:
| Q |
47 |
atcttgttctctgggattttacggagactgaggagtctgtgattttgcggtcgaatcttgtcgctgacaacgtgaggaaggaagagattgatgtctgtgt |
146 |
Q |
| |
|
||||||||||||| |||||| |||||| ||||||||| ||||||| |||| |||||| ||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
13875448 |
atcttgttctctgtgattttgaggagaccgaggagtctttgatttttcggttgaatctggtcgccaacaacgtgaggaaggaagagattgatgtctgtgt |
13875349 |
T |
|
| Q |
147 |
tgatcacggtactctcaggattgaggatgttcttcccggtcgaaatctgttttcagtaacacttaacttg-aagggaagcactgcgactttgttaacact |
245 |
Q |
| |
|
|||||||||||||||||||||| |||||| |||||| |||||||||| ||||||| ||||| ||||| |||||||||| | |||| ||||||||||| |
|
|
| T |
13875348 |
tgatcacggtactctcaggattaaggatgctcttccaggtcgaaatcgattttcaggtacactcgacttgaaagggaagcatttcgacgttgttaacact |
13875249 |
T |
|
| Q |
246 |
aaagccaaaatgatagagaacaatttc |
272 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
13875248 |
aaagccaaaatgatagagaacaatttc |
13875222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University