View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8521A_low_152 (Length: 279)
Name: NF8521A_low_152
Description: NF8521A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8521A_low_152 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 7 - 267
Target Start/End: Original strand, 48993496 - 48993756
Alignment:
| Q |
7 |
gacagatagtttggaaattttggcaggtgcaatggtgccttgtgtgatgcttatactagggggaatgctagctgaaggaccaaatgactcaacacttgga |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
48993496 |
gacagatagtttggaaattttggcaggtgcaatggtgccttgtgtgatgcttatactagggggtatgctagctgaaggaccaaatgaatcaacacttgga |
48993595 |
T |
|
| Q |
107 |
attaaaactacaattgggataattgtggcaagacttgtggtgcttcctgttataggaattggagttgttgtgttggctgataagttgaattttttggttg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48993596 |
attaaaactacaattgggataattgtggcaagacttgtggtgcttcctgttataggaattggagttgttgtgttggctgataagttgaattttttggttg |
48993695 |
T |
|
| Q |
207 |
aaaatgatgctatgtttaggtttgtgcttttgttgcaatatacaacaccaagtgctatttt |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48993696 |
aaaatgatgctatgtttaggtttgtgcttttgttgcaatatacaacaccaagtgctatttt |
48993756 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 97; Significance: 1e-47; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 8 - 264
Target Start/End: Complemental strand, 22624233 - 22623977
Alignment:
| Q |
8 |
acagatagtttggaaattttggcaggtgcaatggtgccttgtgtgatgcttatactagggggaatgctagctgaaggaccaaatgactcaacacttggaa |
107 |
Q |
| |
|
||||||||||| || ||||| | |||||||||||||||| ||||||||||||| ||||||| ||||| ||||||||||||||||| || | ||||||| |
|
|
| T |
22624233 |
acagatagtttagagattttaggtggtgcaatggtgccttctgtgatgcttatattagggggtatgcttgctgaaggaccaaatgagtctagacttggac |
22624134 |
T |
|
| Q |
108 |
ttaaaactacaattgggataattgtggcaagacttgtggtgcttcctgttataggaattggagttgttgtgttggctgataagttgaattttttggttga |
207 |
Q |
| |
|
||| |||||| ||||| || ||||||||||||| ||||||| |||||| | || ||||| |||||| ||| | ||||| | ||||| ||||| || |
|
|
| T |
22624133 |
ttagaactactattggtattgttgtggcaagactcttggtgctacctgttcttggtattgggattgttgctttgtcgaataagctaaatttcttggtcga |
22624034 |
T |
|
| Q |
208 |
aaatgatgctatgtttaggtttgtgcttttgttgcaatatacaacaccaagtgctat |
264 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| || ||| |||| |||||||| |
|
|
| T |
22624033 |
aaatgatgctatgtttagatttgtgcttttgttgcagtacacatcacctagtgctat |
22623977 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University