View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8521A_low_163 (Length: 271)
Name: NF8521A_low_163
Description: NF8521A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8521A_low_163 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 147; Significance: 1e-77; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 41 - 195
Target Start/End: Complemental strand, 28519269 - 28519115
Alignment:
| Q |
41 |
aacctgtgtccaaaagagcaacaactatgtcgcgttctaatttcaatcttctcttagcagtcagaggtaaaccaatgaagttccatgatcttgttgtgtg |
140 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28519269 |
aacctgtgtccaaaagagcaacaactatgtcgcgttctaatttcaatcttctcttggcagtcagaggtaaaccaatgaagttccatgatcttgttgtgtg |
28519170 |
T |
|
| Q |
141 |
tagcttacggtattgatttttaaacaccaaaagtacttcatccatggctacacat |
195 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28519169 |
taacttacggtattgatttttaaacaccaaaagtacttcatccatggctacacat |
28519115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 221 - 264
Target Start/End: Complemental strand, 28519089 - 28519046
Alignment:
| Q |
221 |
caatatctacaaattttaagctagagaaaaaattatacacacca |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28519089 |
caatatctacaaattttaagctagagaaaaaattatacacacca |
28519046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 89 - 158
Target Start/End: Original strand, 12728763 - 12728832
Alignment:
| Q |
89 |
ttctcttagcagtcagaggtaaaccaatgaagttccatgatcttgttgtgtgtagcttacggtattgatt |
158 |
Q |
| |
|
|||||||||| |||| ||||| ||||| |||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
12728763 |
ttctcttagctgtcaatggtaatccaataaagtcccatgatcttgttgtgtgtagcttgcggtattgatt |
12728832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 89 - 152
Target Start/End: Complemental strand, 34291425 - 34291362
Alignment:
| Q |
89 |
ttctcttagcagtcagaggtaaaccaatgaagttccatgatcttgttgtgtgtagcttacggta |
152 |
Q |
| |
|
|||||||||| |||| |||||| ||||| || | |||||||||||||||||||||||| ||||| |
|
|
| T |
34291425 |
ttctcttagctgtcaaaggtaatccaataaaatcccatgatcttgttgtgtgtagcttgcggta |
34291362 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University