View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8521A_low_189 (Length: 256)
Name: NF8521A_low_189
Description: NF8521A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8521A_low_189 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 27 - 246
Target Start/End: Complemental strand, 30093018 - 30092799
Alignment:
| Q |
27 |
tgttggaaagcaggtaataatataagtggggaatttattgtactggttttgtgatgctaaatgtatatattggtggtttatagaaaggaattgtatagca |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30093018 |
tgttggaaagcaggtaataatataagtggggaatttattgtactggttttgtgatgctaaatgtatatattggtggtttatagaaaggaattgtatagca |
30092919 |
T |
|
| Q |
127 |
ttagcatctagtttggcaataaaataaagttatgttgatgtgtattaattttattcccttggtttggtacatgaccattgtccttgtcctttcaaagttt |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30092918 |
ttagcatctagtttggcaataaaataaagttatgttgatgtgtattaattttattcccttggtttggtacatgaccattgtccttgtcctttcaaagttt |
30092819 |
T |
|
| Q |
227 |
aaagtagtatatgtagtatt |
246 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
30092818 |
aaagtagtatatgtagtatt |
30092799 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University