View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8521A_low_195 (Length: 254)
Name: NF8521A_low_195
Description: NF8521A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8521A_low_195 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 9 - 242
Target Start/End: Complemental strand, 41404390 - 41404157
Alignment:
| Q |
9 |
tatttcatatggtttctgttcaatcgacttagaaggaagtcaaggaacacaattgcttgcgagtagagcacatgccaaaaatgactctaattgactcgta |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41404390 |
tatttcatatggtttctgttcaatcgacttagaaggaagtcaaggaacacaattgcttgcgagtagagcacatgccaaaaatgactctaattgactcgta |
41404291 |
T |
 |
| Q |
109 |
atctatcaaacatgtcttatagggtctgattcctactttcatacacatcatttcattgcagccacacgattgaaggtcttttgactgccaaaaccagaat |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||| |
|
|
| T |
41404290 |
atctatcaaacatgtcttatagggtctgattcctactttcatacacatcatttcattgcagccacacgattgaaggtcttttgactgcgaataccagaat |
41404191 |
T |
 |
| Q |
209 |
ctactatttatagcttcaacgtaaatgtgatatt |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
41404190 |
ctactatttatagcttcaacgtaaatgtgatatt |
41404157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University