View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8521A_low_199 (Length: 250)
Name: NF8521A_low_199
Description: NF8521A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8521A_low_199 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 153 - 242
Target Start/End: Complemental strand, 38059565 - 38059474
Alignment:
| Q |
153 |
gcatattgcattattctattatgaccttatctgctccaaggatttctctgtgtcccttgaacacat--aagaaggtatactctgttcatttc |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||| | |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38059565 |
gcatattgcattattctattatgaccttatctgctacaaggatttctttatgtcccttgaacacatgagagaaggtatactctgttcatttc |
38059474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 153 - 242
Target Start/End: Original strand, 38060889 - 38060980
Alignment:
| Q |
153 |
gcatattgcattattctattatgaccttatctgctccaaggatttct--ctgtgtcccttgaacacataagaaggtatactctgttcatttc |
242 |
Q |
| |
|
||||||| ||||| |||||||||| |||| |||| |||||| |||| |||||||||||| ||| || ||||||||||| |||||||||| |
|
|
| T |
38060889 |
gcatattacattactctattatgaacttagatgcttcaaggaattctatctgtgtcccttggacaaatgtgaaggtatactttgttcatttc |
38060980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University