View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8521A_low_200 (Length: 250)
Name: NF8521A_low_200
Description: NF8521A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8521A_low_200 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 39 - 249
Target Start/End: Original strand, 31425360 - 31425570
Alignment:
| Q |
39 |
tttattgcacgttaatgtcgcattctttcatagttaatgatgttgataccatatcgtctgatacttaatcaacaataatttgtggttgggttttggttcc |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31425360 |
tttattgcacgttaatgtcgcattctttcatagttaatgatgttgataccatatcgtctgatacttaatcaacaataatttgtggttgggttttggttcc |
31425459 |
T |
 |
| Q |
139 |
aatttatttatttttgtgacaaactaacaatttagttttttctcatgaagtacgtaatattattttcgtggttttctaaagtaaccttttgatttttaag |
238 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31425460 |
aatttatttatttttgcgacaaactaacaatttagttttttctcatgaagtacctaatattattttcgtggttttctaaagtaaccttttgatttttaag |
31425559 |
T |
 |
| Q |
239 |
cgaaaagacta |
249 |
Q |
| |
|
||||||||||| |
|
|
| T |
31425560 |
cgaaaagacta |
31425570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University