View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8521A_low_223 (Length: 249)
Name: NF8521A_low_223
Description: NF8521A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8521A_low_223 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 24 - 240
Target Start/End: Original strand, 417224 - 417441
Alignment:
| Q |
24 |
gaaacagcaatgcaataataacaattagtaagcagaaccatgacatcactaacagaaattgggataacaccattataactaaatgacactaattcttgta |
123 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
417224 |
gaaacagcaatgcaacaataataattagtaagcagaaccatgacatcactaacagaaattgggataacaccattataactaaatgacactaattcttgta |
417323 |
T |
|
| Q |
124 |
acttgctgctgtgatccatattgttgcagcagcaggtcaattgttcctcttgataccaacacaacacttgatcc-ttttttatgtcacacttactccacc |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
417324 |
acttgctgctgtgatccatattgttgcagcagcaggtcaattgttcctcttgataccaacacaacacttgatcctttttttatgtcacacttactccacc |
417423 |
T |
|
| Q |
223 |
tgctacttctatattgtt |
240 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
417424 |
tgctacttctatattgtt |
417441 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University