View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8521A_low_233 (Length: 245)
Name: NF8521A_low_233
Description: NF8521A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8521A_low_233 |
 | |
|
| [»] chr4 (3 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 24 - 245
Target Start/End: Original strand, 33810561 - 33810783
Alignment:
| Q |
24 |
gtgtgtccttggggtgatcaccc-ttaaactggtgctgatatattgaggatgaggaggagcataaggttgttgcactggcatgccataacttggcatttg |
122 |
Q |
| |
|
||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33810561 |
gtgtgtccttggggtgatcaccccttgaactggtgctgatatattgaggatgaggaggagcataaggttgttgcactggcatgccataacttggcatttg |
33810660 |
T |
|
| Q |
123 |
tatgacatagctttgaggggggtagttatgattatgatctgtttcatttacggcaggatactgcataatgttattggtggaattagtcctttaaccaaca |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33810661 |
tatgacatagctttgaggggggtagttatgactatgatctgtttcatttacggaaggatactgcataatgttattggtggaattagtcctttaaccaaca |
33810760 |
T |
|
| Q |
223 |
cacaattttctttattatcttag |
245 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
33810761 |
cacaattttctttattatcttag |
33810783 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 76 - 138
Target Start/End: Original strand, 33815830 - 33815892
Alignment:
| Q |
76 |
ggaggagcataaggttgttgcactggcatgccataacttggcatttgtatgacatagctttga |
138 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
33815830 |
ggaggagcataaggttgttgcactggcatgccataacttggcatttgtaggacatagccttga |
33815892 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 155 - 244
Target Start/End: Original strand, 33815924 - 33816007
Alignment:
| Q |
155 |
tatgatctgtttcatttacggcaggatactgcataatgttattggtggaattagtcctttaaccaacacacaattttctttattatctta |
244 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||| |||||||||| || ||||||||||||| | ||||||||||||||||| |
|
|
| T |
33815924 |
tatgatctgtttcacttacggcaggata---cataatgttgttggtggaat---tcatttaaccaacacaaacttttctttattatctta |
33816007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University