View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8521A_low_255 (Length: 242)
Name: NF8521A_low_255
Description: NF8521A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8521A_low_255 |
 | |
|
| [»] chr1 (4 HSPs) |
| |
|
| [»] chr2 (4 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 222; Significance: 1e-122; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 13 - 242
Target Start/End: Complemental strand, 33810973 - 33810744
Alignment:
| Q |
13 |
tttggagtggttggaggtatagagtaaagggatggctcgagatggtagcgttgtccctgctgacccacaggctcttgtgaagaagaagacacagtcttct |
112 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33810973 |
tttgaagtggttggaggtatagggtaaagggatggctcgagatggtagcgttgtccctgctgacccacaggctcttgtgaagaagaagacacagtcttct |
33810874 |
T |
|
| Q |
113 |
agaagctggattgcttttgatggtactggccaagggtctttgcttgatgtggacaagtatgctatcatgcatagggttcagattaatgcacgtgatctta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33810873 |
agaagctggattgcttttgatggtactggccaagggtctttgcttgatgtggacaagtatgctatcatgcatagggttcagattaatgcacgtgatctta |
33810774 |
T |
|
| Q |
213 |
gaatccttgatcccttgctctcttacccct |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
33810773 |
gaatccttgatcccttgctctcttacccct |
33810744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 13 - 242
Target Start/End: Complemental strand, 33870442 - 33870213
Alignment:
| Q |
13 |
tttggagtggttggaggtatagagtaaagggatggctcgagatggtagcgttgtccctgctgacccacaggctcttgtgaagaagaagacacagtcttct |
112 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33870442 |
tttgaagtggttggaggtatagggtaaagggatggctcgagatggtagcgttgtccctgctgacccacaggctcttgtgaagaagaagacacagtcttct |
33870343 |
T |
|
| Q |
113 |
agaagctggattgcttttgatggtactggccaagggtctttgcttgatgtggacaagtatgctatcatgcatagggttcagattaatgcacgtgatctta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33870342 |
agaagctggattgcttttgatggtactggccaagggtctttgcttgatgtggacaagtatgctatcatgcatagggttcagattaatgcacgtgatctta |
33870243 |
T |
|
| Q |
213 |
gaatccttgatcccttgctctcttacccct |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
33870242 |
gaatccttgatcccttgctctcttacccct |
33870213 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 93 - 242
Target Start/End: Complemental strand, 33831068 - 33830919
Alignment:
| Q |
93 |
agaagaagacacagtcttctagaagctggattgcttttgatggtactggccaagggtctttgcttgatgtggacaagtatgctatcatgcatagggttca |
192 |
Q |
| |
|
||||||||||||||||||||| ||| |||||| ||||||| ||| |||||||||| | | ||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
33831068 |
agaagaagacacagtcttctacaagttggattcagtttgatgctacaggccaagggtggattcatgatgtggacaagtatgttatcatgaatagggttca |
33830969 |
T |
|
| Q |
193 |
gattaatgcacgtgatcttagaatccttgatcccttgctctcttacccct |
242 |
Q |
| |
|
||| |||||||||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
33830968 |
tattgatgcacgtgatcttagaatccttgatcctttgccctcttacccct |
33830919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 93 - 242
Target Start/End: Complemental strand, 33893231 - 33893082
Alignment:
| Q |
93 |
agaagaagacacagtcttctagaagctggattgcttttgatggtactggccaagggtctttgcttgatgtggacaagtatgctatcatgcatagggttca |
192 |
Q |
| |
|
||||||||||||||||||||| ||| |||||| ||||||| ||| |||||||||| | | ||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
33893231 |
agaagaagacacagtcttctacaagttggattcagtttgatgctacaggccaagggtggattcatgatgtggacaagtatgttatcatgaatagggttca |
33893132 |
T |
|
| Q |
193 |
gattaatgcacgtgatcttagaatccttgatcccttgctctcttacccct |
242 |
Q |
| |
|
||| |||||||||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
33893131 |
tattgatgcacgtgatcttagaatccttgatcctttgccctcttacccct |
33893082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 108; Significance: 2e-54; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 87 - 242
Target Start/End: Original strand, 24408805 - 24408960
Alignment:
| Q |
87 |
ttgtgaagaagaagacacagtcttctagaagctggattgcttttgatggtactggccaagggtctttgcttgatgtggacaagtatgctatcatgcatag |
186 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||||||||||| ||| ||| |||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
24408805 |
ttgtgaagaagaagacacagtcttttggaagctggattgctttggatagtaatggccactggtctcaaattgatgtggacaagtatgctatcatgcatag |
24408904 |
T |
|
| Q |
187 |
ggttcagattaatgcacgtgatcttagaatccttgatcccttgctctcttacccct |
242 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24408905 |
ggttcagattaatgcacatgatcttagaatccttgatcccttgctctcttacccct |
24408960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 156 - 242
Target Start/End: Complemental strand, 24410211 - 24410125
Alignment:
| Q |
156 |
ttgatgtggacaagtatgctatcatgcatagggttcagattaatgcacgtgatcttagaatccttgatcccttgctctcttacccct |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24410211 |
ttgatgtggacaagtatgctatcatgcatagggttcagattaatgcatgtgatcttagaatccttgatcccttgctctcttacccct |
24410125 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 87 - 129
Target Start/End: Complemental strand, 24410676 - 24410634
Alignment:
| Q |
87 |
ttgtgaagaagaagacacagtcttctagaagctggattgcttt |
129 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
24410676 |
ttgtgaagaagaagacacagtcttttggaagctggattgcttt |
24410634 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 35 - 66
Target Start/End: Original strand, 24408777 - 24408808
Alignment:
| Q |
35 |
agtaaagggatggctcgagatggtagcgttgt |
66 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
24408777 |
agtaaagggatggctcgagatggtagcgttgt |
24408808 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University