View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8521A_low_256 (Length: 242)
Name: NF8521A_low_256
Description: NF8521A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8521A_low_256 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 7654167 - 7653938
Alignment:
| Q |
1 |
gaatgagtgtgatatatattataagttgtgttgtgacatgagtaaggagacattttgtatacgagtgttagaaaagtaaatcatgattgctagccacata |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
7654167 |
gaatgagtgtgatatatattataaattgtgttgtgacatgagtaaggagacattttgtatacgagtgttagaaaagtaaatcatgattgctaatcacata |
7654068 |
T |
|
| Q |
101 |
tactttcatattaatcatcaatgtatcaatagtatccttcaagtgggtttcttgcacaagatggnnnnnnnnnnnnnnnnnnggtttctaatatgtttct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
7654067 |
tactttcatattaatcatcaatgtatcaataatatccttcaagtgggtttcttgcacaagatggttttcttttttactttttggtttctaatatgtttct |
7653968 |
T |
|
| Q |
201 |
tgcacaagaagtaatcctattcgagatatt |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
7653967 |
tgcacaagaagtaatcctattcgagatatt |
7653938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University