View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8521A_low_263 (Length: 241)
Name: NF8521A_low_263
Description: NF8521A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8521A_low_263 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 9 - 241
Target Start/End: Complemental strand, 3016175 - 3015943
Alignment:
| Q |
9 |
atcatagatgatggatttgtcagcattttgtgattgtcttagagttagattatcatttttaagatcttacatattaatattcttctaccattgtaagtaa |
108 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||| ||||||| |||||| |||||||||| |
|
|
| T |
3016175 |
atcatagatgatggatttgtcagcattttatgattgtcttagagttagattatcatttttaagatcatacatatcaatattcgtctaccgttgtaagtaa |
3016076 |
T |
|
| Q |
109 |
acaggcttgaggaataaaaagagaaaattgaagggggnnnnnnngctgatcaagattacagaaatcttgtgtcaacgttctattacaatgttgtcatgtt |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3016075 |
acaggcttgaggaataaaaagagaaaattgaagggggaaaaaaagctgatcaagattacagaaatcttgtgtcaactttctattacaatgttgtcatgtt |
3015976 |
T |
|
| Q |
209 |
tgaacttgttctcactattattacaattccatg |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
3015975 |
tgaacttgttctcactattattacaattccatg |
3015943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University