View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8521A_low_267 (Length: 239)
Name: NF8521A_low_267
Description: NF8521A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8521A_low_267 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 14 - 219
Target Start/End: Complemental strand, 21491671 - 21491466
Alignment:
| Q |
14 |
gaagaatataaataattgagtctagttttatgtttagtttcatagctttaattaattggtaatgtgtctcataaactatgttaattttgcgtgtatgttt |
113 |
Q |
| |
|
|||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
21491671 |
gaagaaaataaataattgagtctagttttatatttagtttcatagctttaattaattggtaatgtgtctcataaactatgttaattttgcatgtatgttt |
21491572 |
T |
|
| Q |
114 |
ggattaacggtaagtttgtccgagttaccgtgtcactgtgatttggtcaaatttgttgtcattctaaatatgcaagacaatggttttcttttgagctatg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21491571 |
ggattaacggtaagtttgtccgagttaccgtgtcactgtgatttggtcaaatttgttgtcattctaaatatgcaagacaatggttttcttttgagctatg |
21491472 |
T |
|
| Q |
214 |
aattat |
219 |
Q |
| |
|
|||||| |
|
|
| T |
21491471 |
aattat |
21491466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University