View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8521A_low_269 (Length: 239)

Name: NF8521A_low_269
Description: NF8521A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8521A_low_269
NF8521A_low_269
[»] chr4 (2 HSPs)
chr4 (31-214)||(29561221-29561406)
chr4 (92-214)||(29557421-29557541)


Alignment Details
Target: chr4 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 31 - 214
Target Start/End: Complemental strand, 29561406 - 29561221
Alignment:
31 agaaagaaaaaca--tgctgctagaggtggattactggttccaaagcgaatgccgttccaagacattggaaacaactcgtcgttgttgatgaggcagcaa 128  Q
    |||||||||||||  |||||||||||||||| |||| |||||||| ||||||||||||||||||||||| |||||||| || ||||||| |||||||||     
29561406 agaaagaaaaacacatgctgctagaggtggactactagttccaaaacgaatgccgttccaagacattgggaacaactcttcattgttgacgaggcagcag 29561307  T
129 aatggcaaagcagttttccctttgcattgccatctttcttcaaatgctgagaaaactaatcgcttgaatgaatgctgatcagttct 214  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||| |||||| ||||||    
29561306 aatggcaaagcagttttccctttgcattgccatctttcttcaaatgctgagaaaacttatcacttgaatgaacgctgattagttct 29561221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 92 - 214
Target Start/End: Complemental strand, 29557541 - 29557421
Alignment:
92 cattggaaacaactcgtcgttgttgatgaggcagcaaaatggcaaagcagttttccctttgcattgccatctttcttcaaatgctgagaaaactaatcgc 191  Q
    ||||||||| |||||||| |||||||||| ||| || | |||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| | | |    
29557541 cattggaaataactcgtcattgttgatgaagca-cagagtggcaaagcagttttctctttgcattgccatatttcttcaaatgctgag-aaacttagcac 29557444  T
192 ttgaatgaatgctgatcagttct 214  Q
    |||||||||||||||| ||||||    
29557443 ttgaatgaatgctgataagttct 29557421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University