View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8521A_low_274 (Length: 237)
Name: NF8521A_low_274
Description: NF8521A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8521A_low_274 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 52763386 - 52763617
Alignment:
| Q |
1 |
ggtaatggactcaaaacatttgtatgaacaaatcctttattagttagtattcctcttagagataggtttaagcagttgtttgagttggctgaaaatcgtt |
100 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
52763386 |
ggtaatggactcaaatcatctgtatgaacaaatcctttattaggtagtattcctcttagagataggtttaagcagttgtttgaattggctgaaaatcgtt |
52763485 |
T |
|
| Q |
101 |
ggattttggcggcggagatgttttctttannnnnnnnnnnnnnnnnnnnnnnnntatgaaggcataaaagtggcggtggaggctgttactttgcatgttg |
200 |
Q |
| |
|
||||||| |||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52763486 |
ggattttagcggcggagatgttttatttagggtgggtgggggtgggggtggggttatgaaggcataaaagtggcggtggaggctgttactttgcatgttg |
52763585 |
T |
|
| Q |
201 |
atattgaagaccattgacgatgacaactagat |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
52763586 |
atattgaagaccattgacgatgacaactagat |
52763617 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University