View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8521A_low_276 (Length: 235)
Name: NF8521A_low_276
Description: NF8521A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8521A_low_276 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 31425553 - 31425781
Alignment:
| Q |
1 |
ttttaagcgaaaagactatactaatatcgagttcatctgaatctttagtaagtaaaatttagcaaaaaattgttccaccgttgaacttggaatttttcaa |
100 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31425553 |
ttttaagcgaaaagactaaactaatctcgagttcatccgaatatttagtaagtaaaatttagcaaaaaattgttccaccgttgaacttggaatttttcaa |
31425652 |
T |
 |
| Q |
101 |
atgatttgtcatagagagcatatcaaccacttgagacaaatcaattaatttatagnnnnnnnnnnnnnggtgaaaatcgggtgtccttcgtgcatgcaac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||| | |||||||| ||||||||||||||||| |||| |
|
|
| T |
31425653 |
atgatttgtcatagagagcatatcaaccactcgagacaaatcaattaatttattgttatttttttttttgtgaaaatggggtgtccttcgtgcatacaac |
31425752 |
T |
 |
| Q |
201 |
tgcagagactaatctcttgagtcttgtag |
229 |
Q |
| |
|
|| ||||||||||||||| |||||||||| |
|
|
| T |
31425753 |
tgtagagactaatctcttaagtcttgtag |
31425781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 36; Significance: 0.00000000002; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 174 - 225
Target Start/End: Original strand, 24579434 - 24579485
Alignment:
| Q |
174 |
aaatcgggtgtccttcgtgcatgcaactgcagagactaatctcttgagtctt |
225 |
Q |
| |
|
||||||||| |||| |||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
24579434 |
aaatcgggtatcctccgtgtatgcaactgcagagactaatctctcgagtctt |
24579485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 169 - 227
Target Start/End: Complemental strand, 1424739 - 1424681
Alignment:
| Q |
169 |
ggtgaaaatcgggtgtccttcgtgcatgcaactgcagagactaatctcttgagtcttgt |
227 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||| ||||||||||||| |||||||| |
|
|
| T |
1424739 |
ggtgtaaatcgggtgtccttcgtgcgcgcaactgcggagactaatctctcaagtcttgt |
1424681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University