View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8521A_low_281 (Length: 231)
Name: NF8521A_low_281
Description: NF8521A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8521A_low_281 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 7 - 221
Target Start/End: Complemental strand, 10200312 - 10200095
Alignment:
| Q |
7 |
gttattgccccatgaaccaccaccac---taccaccattgttattgttattgccgccggtgggaagggctgaaaggcgaaaagggtgagaaggggttagt |
103 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10200312 |
gttattgccccatgaaccaccaccaccactaccaccattgttattgttattgccgccggtgggaagggctgaaaggcgaaaagggtgagaaggggttagt |
10200213 |
T |
 |
| Q |
104 |
ttaatggacgaaaaagggttgaaagtggtgaccgggaaatgtgggggcggtggtggacnnnnnnnnnnnnnaagaggaggaagaagggaaacggtgatgc |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
10200212 |
ttaatggacgaaaaagggttgaaagtggtgaccgggaaatgtgggggtggtggtgaacggtggcggaggtgaagaggaggaagaagggaaacggtgatgc |
10200113 |
T |
 |
| Q |
204 |
aagtgtagcccatattgt |
221 |
Q |
| |
|
||||||||||||| |||| |
|
|
| T |
10200112 |
aagtgtagcccatgttgt |
10200095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University