View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8521A_low_284 (Length: 230)
Name: NF8521A_low_284
Description: NF8521A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8521A_low_284 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 25933608 - 25933834
Alignment:
| Q |
1 |
tgtttcctttgcaagcaggcttttactaatggaatatgcaacccatcttttaagaattgctacaacattatttgaagcaatggttaagaaccttgagctg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25933608 |
tgtttcctttgcaagcaggcttttactaatggaatatgcaacccatcttttaagaattgctacaacattatttgaagcaatggttaagaaccttgagctg |
25933707 |
T |
 |
| Q |
101 |
aatctgaaaacaacaaagtcatatttatcagaaaacaatggcaacatacgtgtctatcgttatccacccactgatgttggttggggcatggaggttcata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25933708 |
aatctgaaaacaacaaagtcatatttatcagaaaacaatggcaacatacgtgtctatcgttatccacccactgatgttggttggggcatggaggttcata |
25933807 |
T |
 |
| Q |
201 |
cagatagttcagtgttgtccatattga |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
25933808 |
cagatagttcagtgttgtccatattga |
25933834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University