View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8521A_low_311 (Length: 228)
Name: NF8521A_low_311
Description: NF8521A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8521A_low_311 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 13245490 - 13245276
Alignment:
| Q |
1 |
ttcttgcagtattggaggaaaccaccaaaaaatttctgactgtcatttatccggtgtgtccttgatccttagaaggccgccaacattccttccttttcga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
13245490 |
ttcttgcagtattggaggaaaccaccaaaaaaattctgaatgtcatttatccggtgtgtccttgatccttagaaggccgccaaaattccttccttttcga |
13245391 |
T |
|
| Q |
101 |
cggctttttggccttagcagcggctgatgacagccagaaatacagttatttcttgtagtgatggtcaccatgtgtcactaaagttttattttgcgtaaga |
200 |
Q |
| |
|
|||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
13245390 |
cggctttttggccttaccagcggcttatgacagccagaaatacagttatttcttgtagtgatggtcaccctgtgtcactaaagttttattttgcgcaaga |
13245291 |
T |
|
| Q |
201 |
gtttcatagcttata |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
13245290 |
gtttcatagcttata |
13245276 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 138 - 209
Target Start/End: Complemental strand, 13266638 - 13266567
Alignment:
| Q |
138 |
aaatacagttatttcttgtagtgatggtcaccatgtgtcactaaagttttattttgcgtaagagtttcatag |
209 |
Q |
| |
|
||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13266638 |
aaatatagttatttcttgtagtgatggtcactctgtgtcactaaagttttattttgcgtaagagtttcatag |
13266567 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University