View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8521A_low_316 (Length: 227)
Name: NF8521A_low_316
Description: NF8521A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8521A_low_316 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 20 - 209
Target Start/End: Complemental strand, 3675535 - 3675346
Alignment:
| Q |
20 |
atatgatgggtttttgtcaaaatttaatttgtatggaactttaattaataannnnnnnaatcttaggtatttgcttgtggtagcattttttacaagtata |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3675535 |
atatgatgggtttttgtcaaaatttaatttgtatggaactttaattaataatttttttaatcttaggtatttgcttgtggtagcattttttacaagtata |
3675436 |
T |
|
| Q |
120 |
tacacaggaagccaagtgtatcgtcaaattcatgaacttatcactgggaataatatatttcgacctacaactgcagctgtgattgatttt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3675435 |
tacacaggaagccaagtgtatcgtcaaattcatgaacttatcactgggaataatatatttcgacctacaactgcagctgtgattgatttt |
3675346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University