View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8521A_low_321 (Length: 225)
Name: NF8521A_low_321
Description: NF8521A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8521A_low_321 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 23 - 128
Target Start/End: Complemental strand, 6236647 - 6236542
Alignment:
| Q |
23 |
ctcaccacccagctttattgcttcttttctctctagagagggttcaggacttccttattataggattttgatgtaattctgccttttctgtttttgtttc |
122 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
6236647 |
ctcaccaccctgctttattgcttcttttctctctagagagggttcaggacttccttattataggattttgatgtaattctgccttttctatttttgtttc |
6236548 |
T |
|
| Q |
123 |
ttcctg |
128 |
Q |
| |
|
|||||| |
|
|
| T |
6236547 |
ttcctg |
6236542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 126 - 206
Target Start/End: Complemental strand, 12384300 - 12384220
Alignment:
| Q |
126 |
ctgccacataccactgatatatgttggttccgnnnnnnnnnnnnngacatgtgtaattcttgcctttcttgtagttaacca |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
12384300 |
ctgccacataccactgatatatgttggttccgtttttgtttttttggcatgtgtaattcttgcctttcttgtagttaacca |
12384220 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 173 - 206
Target Start/End: Complemental strand, 11990239 - 11990206
Alignment:
| Q |
173 |
catgtgtaattcttgcctttcttgtagttaacca |
206 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |
|
|
| T |
11990239 |
catgtgtaattcttgcctttcttctagttaacca |
11990206 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University